ID: 989545343_989545349

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 989545343 989545349
Species Human (GRCh38) Human (GRCh38)
Location 5:42665985-42666007 5:42665999-42666021
Sequence CCACCAGCTCCCTCTCATGACAC TCATGACACATGCGGATTATGGG
Strand - +
Off-target summary {0: 1, 1: 36, 2: 430, 3: 1400, 4: 3824} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!