|
Left Crispr |
Right Crispr |
| Crispr ID |
989588160 |
989588164 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:43089076-43089098
|
5:43089091-43089113
|
| Sequence |
CCAGCTTCGGCTCGGCATCAGAG |
CATCAGAGGGAGACCGTGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 419, 1: 561, 2: 478, 3: 168, 4: 133} |
{0: 87, 1: 19, 2: 6, 3: 18, 4: 219} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|