ID: 989697864_989697868

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 989697864 989697868
Species Human (GRCh38) Human (GRCh38)
Location 5:44224874-44224896 5:44224889-44224911
Sequence CCCTTTTCTGCTCTGATGCCTGC ATGCCTGCCATGGCATCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 379} {0: 1, 1: 0, 2: 1, 3: 14, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!