ID: 990484140_990484143

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 990484140 990484143
Species Human (GRCh38) Human (GRCh38)
Location 5:56241608-56241630 5:56241635-56241657
Sequence CCTAGAGACTTGTTGAATAGCTT CAAAATGCTGATAGTGATATGGG
Strand - +
Off-target summary {0: 76, 1: 1564, 2: 1914, 3: 1405, 4: 934} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!