ID: 991033541_991033545

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 991033541 991033545
Species Human (GRCh38) Human (GRCh38)
Location 5:62105892-62105914 5:62105931-62105953
Sequence CCCTGCCATTTTCTGCAGATAAC GACAGCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary {0: 12, 1: 195, 2: 171, 3: 143, 4: 299} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!