|
Left Crispr |
Right Crispr |
| Crispr ID |
991066235 |
991066244 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:62427759-62427781
|
5:62427799-62427821
|
| Sequence |
CCCTGCCCCATCTGTGGAAAAAT |
GTCCCTGGTACCAAAAAGGTTGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 69, 1: 1058, 2: 1747, 3: 1392, 4: 931} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|