ID: 991209250_991209256

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 991209250 991209256
Species Human (GRCh38) Human (GRCh38)
Location 5:64085213-64085235 5:64085258-64085280
Sequence CCACAGTCACTGCACTCTCCCTC CATGCAATGTAGCCAGTGCCAGG
Strand - +
Off-target summary {0: 7, 1: 40, 2: 114, 3: 208, 4: 607} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!