ID: 991396471_991396473

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 991396471 991396473
Species Human (GRCh38) Human (GRCh38)
Location 5:66209500-66209522 5:66209518-66209540
Sequence CCTGAAGAAAATTTTTCAGTGGC GTGGCTTCCCAGTGCCCTCAGGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 5, 3: 60, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!