ID: 991782968_991782976

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 991782968 991782976
Species Human (GRCh38) Human (GRCh38)
Location 5:70159652-70159674 5:70159676-70159698
Sequence CCTTGTCTCCATGTTTCACATCC GGGCATGTTAATGCAAGGGGTGG
Strand - +
Off-target summary No data {0: 2, 1: 6, 2: 60, 3: 250, 4: 1048}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!