ID: 992242953_992242956

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 992242953 992242956
Species Human (GRCh38) Human (GRCh38)
Location 5:74789842-74789864 5:74789876-74789898
Sequence CCATCTTCTGCAGATAACTGCTC AACAGTTCTTGGCCTGTTACTGG
Strand - +
Off-target summary No data {0: 4, 1: 13, 2: 202, 3: 231, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!