ID: 992306625_992306629

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 992306625 992306629
Species Human (GRCh38) Human (GRCh38)
Location 5:75446890-75446912 5:75446904-75446926
Sequence CCCTTCAAGTCTCCTAGAAATCA TAGAAATCACTACAGCCAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 23, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!