ID: 992358460_992358467

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 992358460 992358467
Species Human (GRCh38) Human (GRCh38)
Location 5:76010264-76010286 5:76010290-76010312
Sequence CCCAGCTGTGGGCTCAATCAAGC CATGCCTGCTCGTCAGGGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!