ID: 992381455_992381459

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 992381455 992381459
Species Human (GRCh38) Human (GRCh38)
Location 5:76241721-76241743 5:76241743-76241765
Sequence CCAAGGTGGCCATGTGTGTCAAA AGTCAGGGAATCCCTCCTCCTGG
Strand - +
Off-target summary No data {0: 19, 1: 19, 2: 7, 3: 26, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!