|
Left Crispr |
Right Crispr |
| Crispr ID |
992422641 |
992422647 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:76621972-76621994
|
5:76622004-76622026
|
| Sequence |
CCTTCCTCATCCCTCTTTTCCAT |
GAGACAGAAACTAAAAACCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 26, 2: 40, 3: 159, 4: 1110} |
{0: 56, 1: 73, 2: 34, 3: 60, 4: 539} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|