|
Left Crispr |
Right Crispr |
| Crispr ID |
992514505 |
992514509 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:77477519-77477541
|
5:77477556-77477578
|
| Sequence |
CCCACTCAAAACCGCTCAACTAC |
ACCTGCTCCTGAATGACTACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 13, 1: 53, 2: 62, 3: 56, 4: 96} |
{0: 7186, 1: 3446, 2: 1974, 3: 1828, 4: 2105} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|