|
Left Crispr |
Right Crispr |
| Crispr ID |
993001036 |
993001038 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:82380593-82380615
|
5:82380620-82380642
|
| Sequence |
CCCATATCATTATCAGCATTTTG |
AAGCCATTCAACAAGTCTCTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 13, 1: 55, 2: 78, 3: 80, 4: 363} |
{0: 1428, 1: 1886, 2: 1423, 3: 807, 4: 580} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|