ID: 993159933_993159945

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 993159933 993159945
Species Human (GRCh38) Human (GRCh38)
Location 5:84277165-84277187 5:84277200-84277222
Sequence CCCCAAGATTCATATGTTGAAAT GGCGATGGTATTAAGAGGTGGGG
Strand - +
Off-target summary {0: 3, 1: 273, 2: 1058, 3: 2544, 4: 3892} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!