ID: 993159934_993159936

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 993159934 993159936
Species Human (GRCh38) Human (GRCh38)
Location 5:84277166-84277188 5:84277179-84277201
Sequence CCCAAGATTCATATGTTGAAATT TGTTGAAATTTTAACCCCCAAGG
Strand - +
Off-target summary No data {0: 5, 1: 54, 2: 262, 3: 573, 4: 900}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!