ID: 993521935_993521938

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 993521935 993521938
Species Human (GRCh38) Human (GRCh38)
Location 5:88913706-88913728 5:88913726-88913748
Sequence CCCTCTTCTCAGTGTCAGGAAAA AAACCTCTTTGGAGTTCTATTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!