ID: 993590951_993590961

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 993590951 993590961
Species Human (GRCh38) Human (GRCh38)
Location 5:89794663-89794685 5:89794705-89794727
Sequence CCCGCCACTGACTTCCATCCCTC GCTGTGCTTCTGATCCAGTGAGG
Strand - +
Off-target summary No data {0: 6, 1: 70, 2: 137, 3: 149, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!