|
Left Crispr |
Right Crispr |
| Crispr ID |
993941850 |
993941859 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:94068347-94068369
|
5:94068393-94068415
|
| Sequence |
CCTGCCAGATCCGGAGGGGTGGA |
TGGCAAACAGCAGTGGTGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 15, 1: 49, 2: 110, 3: 147, 4: 224} |
{0: 41, 1: 78, 2: 97, 3: 99, 4: 296} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|