ID: 994533633_994533641

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 994533633 994533641
Species Human (GRCh38) Human (GRCh38)
Location 5:100999613-100999635 5:100999647-100999669
Sequence CCCTCCACCAACCCGAGGCAGAG GAGAATCAGTATGCTCAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!