ID: 995619726_995619736

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 995619726 995619736
Species Human (GRCh38) Human (GRCh38)
Location 5:114011457-114011479 5:114011508-114011530
Sequence CCCTCTGTTTTTGGTAGCCCCTT TCCTACTCTCAAGCTACTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 153} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!