ID: 996113452_996113455 |
View in Genome Browser |
Spacer: 8 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 996113452 | 996113455 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:119592312-119592334 | 5:119592343-119592365 |
| Sequence | CCAAAGGAGATTTCCAATCAGAG | CTGCAGCACCATGCTGTAGGAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 8, 2: 34, 3: 62, 4: 255} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||