ID: 996417571_996417576

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 996417571 996417576
Species Human (GRCh38) Human (GRCh38)
Location 5:123226957-123226979 5:123226981-123227003
Sequence CCTTTTCCATGATAACTATGGCA AGTGGAGTGGAAGAACAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!