ID: 996767878_996767881

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 996767878 996767881
Species Human (GRCh38) Human (GRCh38)
Location 5:127053094-127053116 5:127053112-127053134
Sequence CCTGTTTTTCCTAATCAGTCCAC TCCACAGGAAGAAACCCATTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 29, 4: 154} {0: 1, 1: 0, 2: 0, 3: 19, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!