ID: 996769722_996769735

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 996769722 996769735
Species Human (GRCh38) Human (GRCh38)
Location 5:127073466-127073488 5:127073509-127073531
Sequence CCAACGCCTCTGCTTCCGCCCTG ACCCACCAGGCGCCGGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 255} {0: 1, 1: 0, 2: 2, 3: 14, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!