ID: 996769741_996769751

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 996769741 996769751
Species Human (GRCh38) Human (GRCh38)
Location 5:127073526-127073548 5:127073548-127073570
Sequence CCCAGGCCCCGCACTTCCGCCCC CACGCCGGCAGCACTGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 346} {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!