|
Left Crispr |
Right Crispr |
Crispr ID |
996939809 |
996939816 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:128990897-128990919
|
5:128990943-128990965
|
Sequence |
CCTGCTGGATCTGGAGGGGTGGA |
CGGAGATCAGCAGTGGTGGACGG |
Strand |
- |
+ |
Off-target summary |
{0: 15, 1: 48, 2: 81, 3: 158, 4: 318} |
{0: 1, 1: 4, 2: 30, 3: 120, 4: 316} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|