ID: 997302195_997302198

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 997302195 997302198
Species Human (GRCh38) Human (GRCh38)
Location 5:132814054-132814076 5:132814069-132814091
Sequence CCGGGGGGGCCGGCCTCCGAGCC TCCGAGCCCGCTCAGCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 225} {0: 1, 1: 0, 2: 1, 3: 9, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!