ID: 997393984_997393987

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 997393984 997393987
Species Human (GRCh38) Human (GRCh38)
Location 5:133541806-133541828 5:133541827-133541849
Sequence CCCACTTCTCAAGGAAGCTTAGT GTTCCCTTCAGTGGAAAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 132} {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!