ID: 997405827_997405832

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 997405827 997405832
Species Human (GRCh38) Human (GRCh38)
Location 5:133645846-133645868 5:133645875-133645897
Sequence CCTCCTCTAGAGCCTTTGGAGGG GCCCTCCGAACACCTTGAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!