ID: 997468213_997468222

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 997468213 997468222
Species Human (GRCh38) Human (GRCh38)
Location 5:134102185-134102207 5:134102208-134102230
Sequence CCCCCGCCGCTCTGGGGGGACTC TGGGCCTCGCCTGGGCTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!