ID: 997468219_997468224

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 997468219 997468224
Species Human (GRCh38) Human (GRCh38)
Location 5:134102191-134102213 5:134102210-134102232
Sequence CCGCTCTGGGGGGACTCTGGGCC GGCCTCGCCTGGGCTGAGAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!