ID: 998251965_998251969

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 998251965 998251969
Species Human (GRCh38) Human (GRCh38)
Location 5:140559461-140559483 5:140559488-140559510
Sequence CCAGTGCTTCCTAGTGCCTCCAG ACTCATCACCCTGACCTATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 244} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!