|
Left Crispr |
Right Crispr |
| Crispr ID |
998290334 |
998290339 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:140908541-140908563
|
5:140908580-140908602
|
| Sequence |
CCCAGTAATAGGCCAAGAGCTGT |
AGTTAGCTGCAGAAGATGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 16, 1: 194, 2: 203, 3: 147, 4: 222} |
{0: 1, 1: 8, 2: 207, 3: 203, 4: 339} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|