|
Left Crispr |
Right Crispr |
| Crispr ID |
998322766 |
998322780 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:141247592-141247614
|
5:141247633-141247655
|
| Sequence |
CCGCTCCCAGAGGCGGCCCCGGC |
GCTTACCGTCTACCTGGTGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 6, 3: 33, 4: 301} |
{0: 1, 1: 8, 2: 9, 3: 4, 4: 65} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|