ID: 998322767_998322778

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 998322767 998322778
Species Human (GRCh38) Human (GRCh38)
Location 5:141247597-141247619 5:141247627-141247649
Sequence CCCAGAGGCGGCCCCGGCCCAAG CGACTCGCTTACCGTCTACCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 22, 4: 191} {0: 1, 1: 1, 2: 15, 3: 1, 4: 12}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!