ID: 998352652_998352667

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 998352652 998352667
Species Human (GRCh38) Human (GRCh38)
Location 5:141511509-141511531 5:141511549-141511571
Sequence CCATCCATCCCATGCCTCCCTCC CAGTTCCTCTTTCCCGAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 30, 3: 462, 4: 2448} {0: 1, 1: 0, 2: 0, 3: 9, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!