ID: 998352656_998352671

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 998352656 998352671
Species Human (GRCh38) Human (GRCh38)
Location 5:141511523-141511545 5:141511557-141511579
Sequence CCTCCCTCCTCCCCACCCCACTC CTTTCCCGAGTAAGGTGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 79, 3: 1008, 4: 7406} {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!