ID: 998352659_998352670

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 998352659 998352670
Species Human (GRCh38) Human (GRCh38)
Location 5:141511530-141511552 5:141511556-141511578
Sequence CCTCCCCACCCCACTCCAACAGT TCTTTCCCGAGTAAGGTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 108, 4: 985} {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!