ID: 998352662_998352670

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 998352662 998352670
Species Human (GRCh38) Human (GRCh38)
Location 5:141511535-141511557 5:141511556-141511578
Sequence CCACCCCACTCCAACAGTTCCTC TCTTTCCCGAGTAAGGTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 388} {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!