ID: 998390296_998390303

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 998390296 998390303
Species Human (GRCh38) Human (GRCh38)
Location 5:141783102-141783124 5:141783115-141783137
Sequence CCCTGTGGCCAGGCCACACTCCC CCACACTCCCTAGGGCCAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 21, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!