ID: 999721079_999721090

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 999721079 999721090
Species Human (GRCh38) Human (GRCh38)
Location 5:154399758-154399780 5:154399803-154399825
Sequence CCAATGGCAAATACAACAGATGA GAGTCTGGCAGGGCACAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 184} {0: 1, 1: 0, 2: 0, 3: 46, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!