ID: 999721083_999721091

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 999721083 999721091
Species Human (GRCh38) Human (GRCh38)
Location 5:154399789-154399811 5:154399807-154399829
Sequence CCAACACTGGCCCTGAGTCTGGC CTGGCAGGGCACAGAGGGGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 56, 4: 516}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!