ID: 999721086_999721092

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 999721086 999721092
Species Human (GRCh38) Human (GRCh38)
Location 5:154399799-154399821 5:154399812-154399834
Sequence CCCTGAGTCTGGCAGGGCACAGA AGGGCACAGAGGGGTTGGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 250} {0: 1, 1: 0, 2: 1, 3: 39, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!