ID: 999730825_999730832

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 999730825 999730832
Species Human (GRCh38) Human (GRCh38)
Location 5:154475820-154475842 5:154475855-154475877
Sequence CCAGCGCCCAGACTTGCTGCGGC CCTTTAATCCTCTTCTCGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 500} {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
12 5:154475820-154475842 CCAGCGCCCAGACTTGCTGCGGC - 5:154475855-154475877 CCTTTAATCCTCTTCTCGACTGG +