ID: 999730826_999730833

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 999730826 999730833
Species Human (GRCh38) Human (GRCh38)
Location 5:154475826-154475848 5:154475856-154475878
Sequence CCCAGACTTGCTGCGGCCAGCCG CTTTAATCCTCTTCTCGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 84} {0: 1, 1: 0, 2: 0, 3: 12, 4: 103}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
7 5:154475826-154475848 CCCAGACTTGCTGCGGCCAGCCG - 5:154475856-154475878 CTTTAATCCTCTTCTCGACTGGG +