ID: 999730826_999730838

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 999730826 999730838
Species Human (GRCh38) Human (GRCh38)
Location 5:154475826-154475848 5:154475870-154475892
Sequence CCCAGACTTGCTGCGGCCAGCCG TCGACTGGGCCCAGGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 84} {0: 1, 1: 0, 2: 0, 3: 20, 4: 279}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
21 5:154475826-154475848 CCCAGACTTGCTGCGGCCAGCCG - 5:154475870-154475892 TCGACTGGGCCCAGGGCAGGAGG +