ID: 999730829_999730832

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 999730829 999730832
Species Human (GRCh38) Human (GRCh38)
Location 5:154475842-154475864 5:154475855-154475877
Sequence CCAGCCGGTGCGTCCTTTAATCC CCTTTAATCCTCTTCTCGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 27} {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!